thtools.utils.find_rbs¶
- thtools.utils.find_rbs(ths, rbs, mult_check=False)¶
Get the slice the RBS occupies in a toehold switch sequence.
- Parameters
- thsstr
The toehold switch sequence.
- rbsstr
The ribosome binding site sequence.
- mult_checkbool, default = False
Whether to raise an error if multiple RBS sequences are found.
Examples
>>> import thtools as tt >>> ths = "UUAGCCGCUGUCACACGCACAGGGAUUUACAAAAAGAGGAGAGUAAAAUGCUGUGCGUGCACCAUAAAACGAACAUAGAC" >>> rbs = "AGAGGAGA" >>> tt.find_rbs(ths, rbs) slice(34, 42, None)