thtools.crt.CelsiusRangeResult¶
- class thtools.crt.CelsiusRangeResult(results, celsius_range, meta)¶
Data container for a
CelsiusRangeTest.Not intended to be constructed manually.
Note
All activation and unbinding values are given as decimals, not percentages.
See also
Examples
>>> import thtools as tt >>> ths = "UUAGCCGCUGUCACACGCACAGGGAUUUACAAAAAGAGGAGAGUAAAAUGCUGUGCGUGCACCAUAAAACGAACAUAGAC" >>> rbs = "AGAGGAGA" >>> fasta = tt.FParser.fromspecies("Homo sapiens")[295:305] >>> triggers = fasta.seqs >>> temperatures = range(20, 101, 10) >>> my_test = tt.autoconfig(ths, rbs, triggers) >>> my_crt = tt.CelsiusRangeTest(my_test, temperatures) >>> my_result = my_crt.run(max_size=3, n_samples=200) >>> my_result.plot().show()
(Source code, png, hires.png, pdf)
- Attributes
- resultsSequence[ToeholdResult]
The
ToeholdResultobjects from each temperature.- celsius_rangeSequence[float]
The temperature range tested.
- targetsSequence[str]
The highest activating item from the trigger_sets of each
ToeholdResult.- target_namesSequence[str], optional
The names of each item in
targets.- activationSequence[float]
A list of the switch activation value when bound to the target RNA as the temperature changes.
- rbs_unbindingSequence[float]
A list of the RBS unbinding value when bound to the target RNA as the temperature changes.
- aug_unbindingSequence[float]
A list of the AUG unbinding value when bound to the target RNA as the temperature changes.
- post_aug_unbindingSequence[float]
A list of the post-AUG unbinding value when bound to the target RNA as the temperature changes.
- activation_seSequence[float]
A list of the switch activation’s standard error when bound to the target RNA as the temperature changes.
- specificitySequence[float]
A list of the switch specificity to the target RNA as the temperature changes.
- specificity_seSequence[float]
The standard error of the specificity.
- unix_createddatetime.datetime
The UNIX timestamp of the
CelsiusRangeResult.- datestr
- metadict
- pretty_metastr
- copy()¶
Copy an instance of CelsiusRangeResult.
- property inferred_target¶
The target sequence inferred from the mode of the individual
ToeholdTesthighest activators.
- property inferred_target_name¶
The name of the
inferred_target.
- plot(y='activation', z_score=1.96, swap=False)¶
Plot temperature against activation, with color being the specificity.
The following axes are plotted:
Axis
Value
x
temperature /°C
y
toehold switch activation % (or whatever
yvalue you chose)color
specificity %
- Parameters
- ystr, default = “activation”
The attribute of the test to plot. The options are: - activation - RBS unbinding - AUG unbinding - post-AUG unbinding
- z_scorefloat, default = 1.96
The Z score to multiply SE with when drawing error bars. The default represents a 95% confidence interval.
- swapbool, optional
Whether or not to swap the specificity and activation in the plot. Defaults to False.
- prettify(dp=None)¶
Alias to str(self). Get the result as its
prettytable.PrettyTablein string form, with added metadata.- Parameters
- dpint, optional
The decimal places to use.
- savefig(fname, y='activation', z_score=1.96, swap=False, dpi=1200, **kwargs)¶
Convenience function saving the figure from
plot().See
plot(). All kwargs are passed tomatplotlib.pyplot.savefig().`
- tabulate(dp=None)¶
Create a
prettytable.PrettyTableof the result.- Parameters
- dpint, optional
The decimal places to use.
- to_csv(dp=None, **kwargs)¶
Get the result as a CSV with added metadata.
- Parameters
- dpint, optional
The decimal places to use.
- **kwargs
Extra arguments to be passed to
csv.writer()viaprettytable.PrettyTable.
- to_df(dp=None, **kwargs)¶
Get the result as a pandas DataFrame.
- Parameters
- dpint, optional
The decimal places to limit the display to.
- **kwargs
Extra arguments to be passed to the
pandas.DataFrameinstance.
- to_html(dp=None, **kwargs)¶
Get the result as a HTML table.
- Parameters
- dpint, optional
The decimal places to use.
- **kwargs
Extra arguments to be passed to
PrettyTable.
- to_json(dp=None, **kwargs)¶
Get the result as a JSON string.
- Parameters
- dpint, optional
The decimal places to use.
- **kwargs
Extra arguments to be passed to
PrettyTable.