thtools.utils.autoconfig¶
- thtools.utils.autoconfig(ths, rbs, triggers, set_size=1, model=<nupack.model.Model object>, names=None, const_rna=None)¶
Quick configuration of ToeholdTests, assuming every RNA has the concentration of
thtools.utils.ASSUMED_STRAND_CONC
.- Parameters
- thsstr
The toehold switch
- rbsstr
The ribosome binding site whose slice of the toehold switch will be autodetected
- triggersCollection[str]
An array-like of the triggers to test the toehold switch against
- set_sizeint, default=1
How many triggers to test combinatorically against the toehold switch at a time.
- modelnupack.Model, default=nupack.Model()
The thermodynamic model to use.
- namesCollection[str], optional
The names of each trigger.
- const_rnaIterable, optional
A list of any constant RNAs.
- Returns
- A fully configured
ToeholdTest
instance.
- A fully configured
Examples
>>> import thtools as tt >>> ths = "UUAGCCGCUGUCACACGCACAGGGAUUUACAAAAAGAGGAGAGUAAAAUGCUGUGCGUGCACCAUAAAACGAACAUAGAC" >>> rbs = "AGAGGAGA" >>> triggers = ["CUGUGCGUGUGACAGCGGCUGA", "CUAUACAAUCUACUGUCUUUCC", "UGUACAGCCUCCUAGCUUUCC"] >>> my_test = tt.autoconfig(ths, rbs, triggers) >>> my_result = my_test.run(max_size=3, n_samples=100) >>> my_result.specificity # gives as decimal, not percentage 0.9999999587733204